ID: 999730829_999730833

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 999730829 999730833
Species Human (GRCh38) Human (GRCh38)
Location 5:154475842-154475864 5:154475856-154475878
Sequence CCAGCCGGTGCGTCCTTTAATCC CTTTAATCCTCTTCTCGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 27} {0: 1, 1: 0, 2: 0, 3: 12, 4: 103}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
-9 5:154475842-154475864 CCAGCCGGTGCGTCCTTTAATCC - 5:154475856-154475878 CTTTAATCCTCTTCTCGACTGGG +