ID: 999730830_999730834

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 999730830 999730834
Species Human (GRCh38) Human (GRCh38)
Location 5:154475846-154475868 5:154475862-154475884
Sequence CCGGTGCGTCCTTTAATCCTCTT TCCTCTTCTCGACTGGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 192} {0: 1, 1: 0, 2: 0, 3: 17, 4: 145}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
-7 5:154475846-154475868 CCGGTGCGTCCTTTAATCCTCTT - 5:154475862-154475884 TCCTCTTCTCGACTGGGCCCAGG +