ID: 999730831_999730838

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 999730831 999730838
Species Human (GRCh38) Human (GRCh38)
Location 5:154475855-154475877 5:154475870-154475892
Sequence CCTTTAATCCTCTTCTCGACTGG TCGACTGGGCCCAGGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 78} {0: 1, 1: 0, 2: 0, 3: 20, 4: 279}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
-8 5:154475855-154475877 CCTTTAATCCTCTTCTCGACTGG - 5:154475870-154475892 TCGACTGGGCCCAGGGCAGGAGG +