ID: 377510968 |
View in Genome Browser |
| Species | Mouse (GRCm38) |
| Location | 14:68087408-68087430 |
| Sequence | GAGTGCTGGAGAGGAGCAGG TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 847 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 58, 4: 785} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 377510963_377510968 | 11 | Left | 377510963 | 14:68087374-68087396 | CCAAAGAATCTGAAGAGGAAGAG | 0: 1 1: 0 2: 1 3: 39 4: 352 |
||
| Right | 377510968 | 14:68087408-68087430 | GAGTGCTGGAGAGGAGCAGGTGG | 0: 1 1: 0 2: 3 3: 58 4: 785 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 377510968 | Original CRISPR | GAGTGCTGGAGAGGAGCAGG TGG | Exonic | ||