HTGT WGE

Individual CRISPR Summary

ID: 377510985

 View in Genome Browser
Species Mouse (GRCm38)
Location 14:68087555-68087577
Sequence GTATAATTCTGAGATGACTT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
377510980_377510985 29 Left 377510980 14:68087503-68087525 CCAACCAACCAGTTGAGTTCCAG 0: 1
1: 0
2: 2
3: 8
4: 142
Right 377510985 14:68087555-68087577 GTATAATTCTGAGATGACTTAGG 0: 1
1: 0
2: 1
3: 14
4: 144
377510983_377510985 10 Left 377510983 14:68087522-68087544 CCAGATCCTATACAAATTAAGAA 0: 1
1: 0
2: 1
3: 13
4: 200
Right 377510985 14:68087555-68087577 GTATAATTCTGAGATGACTTAGG 0: 1
1: 0
2: 1
3: 14
4: 144
377510981_377510985 25 Left 377510981 14:68087507-68087529 CCAACCAGTTGAGTTCCAGATCC 0: 1
1: 0
2: 0
3: 5
4: 133
Right 377510985 14:68087555-68087577 GTATAATTCTGAGATGACTTAGG 0: 1
1: 0
2: 1
3: 14
4: 144
377510984_377510985 4 Left 377510984 14:68087528-68087550 CCTATACAAATTAAGAAGTCAAT 0: 1
1: 0
2: 1
3: 34
4: 854
Right 377510985 14:68087555-68087577 GTATAATTCTGAGATGACTTAGG 0: 1
1: 0
2: 1
3: 14
4: 144
377510982_377510985 21 Left 377510982 14:68087511-68087533 CCAGTTGAGTTCCAGATCCTATA 0: 1
1: 0
2: 0
3: 5
4: 86
Right 377510985 14:68087555-68087577 GTATAATTCTGAGATGACTTAGG 0: 1
1: 0
2: 1
3: 14
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
377510985 Original CRISPR GTATAATTCTGAGATGACTT AGG Exonic