ID: 485343920 |
View in Genome Browser |
| Species | Mouse (GRCm38) |
| Location | 5:66975350-66975372 |
| Sequence | AAGTTTGCAAGAGCCCAGTA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 141 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 130} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 485343919_485343920 | 14 | Complete | closest: None total_pairs: 1 max_distance: 1000 |
Left | 485343919 | 5:66975313-66975335 | CCTTTACAGTAGAAAAGCGTTTT | 0: 1 1: 0 2: 0 3: 13 4: 132 |
| Right | 485343920 | 5:66975350-66975372 | AAGTTTGCAAGAGCCCAGTATGG | 0: 1 1: 0 2: 0 3: 10 4: 130 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 485343920 | Original CRISPR | AAGTTTGCAAGAGCCCAGTA TGG | Intronic | ||