ID: 485345259

View in Genome Browser
Species Mouse (GRCm38)
Location 5:66988294-66988316
Sequence ACGCAGCTGGTACTTGAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
485345259_485345265 4 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 485345259 5:66988294-66988316 CCGTTTTCAAGTACCAGCTGCGT 0: 1
1: 0
2: 0
3: 5
4: 74
Right 485345265 5:66988321-66988343 GGGGCCTCGCTAAATTAAAAGGG 0: 1
1: 0
2: 0
3: 3
4: 44
485345259_485345266 5 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 485345259 5:66988294-66988316 CCGTTTTCAAGTACCAGCTGCGT 0: 1
1: 0
2: 0
3: 5
4: 74
Right 485345266 5:66988322-66988344 GGGCCTCGCTAAATTAAAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 56
485345259_485345264 3 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 485345259 5:66988294-66988316 CCGTTTTCAAGTACCAGCTGCGT 0: 1
1: 0
2: 0
3: 5
4: 74
Right 485345264 5:66988320-66988342 AGGGGCCTCGCTAAATTAAAAGG 0: 1
1: 0
2: 0
3: 7
4: 32
485345259_485345267 6 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 485345259 5:66988294-66988316 CCGTTTTCAAGTACCAGCTGCGT 0: 1
1: 0
2: 0
3: 5
4: 74
Right 485345267 5:66988323-66988345 GGCCTCGCTAAATTAAAAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
485345259 Original CRISPR ACGCAGCTGGTACTTGAAAA CGG (reversed) Intronic