ID: 485345265 |
View in Genome Browser |
| Species | Mouse (GRCm38) |
| Location | 5:66988321-66988343 |
| Sequence | GGGGCCTCGCTAAATTAAAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 48 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 44} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 485345263_485345265 | -9 | Complete | closest: None total_pairs: 1 max_distance: 1000 |
Left | 485345263 | 5:66988307-66988329 | CCAGCTGCGTGACAGGGGCCTCG | 0: 1 1: 0 2: 0 3: 7 4: 58 |
| Right | 485345265 | 5:66988321-66988343 | GGGGCCTCGCTAAATTAAAAGGG | 0: 1 1: 0 2: 0 3: 3 4: 44 |
||||
| 485345259_485345265 | 4 | Complete | closest: None total_pairs: 1 max_distance: 1000 |
Left | 485345259 | 5:66988294-66988316 | CCGTTTTCAAGTACCAGCTGCGT | 0: 1 1: 0 2: 0 3: 5 4: 74 |
| Right | 485345265 | 5:66988321-66988343 | GGGGCCTCGCTAAATTAAAAGGG | 0: 1 1: 0 2: 0 3: 3 4: 44 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 485345265 | Original CRISPR | GGGGCCTCGCTAAATTAAAA GGG | Intronic | ||