ID: 1000000593_1000000600

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1000000593 1000000600
Species Human (GRCh38) Human (GRCh38)
Location 5:157135087-157135109 5:157135140-157135162
Sequence CCCTCATTTTTTTTAAGTTTGCA CATAGAAATACTTAACCCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 77, 4: 876} {0: 1, 1: 0, 2: 1, 3: 9, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!