ID: 1000012889_1000012891

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1000012889 1000012891
Species Human (GRCh38) Human (GRCh38)
Location 5:157249275-157249297 5:157249323-157249345
Sequence CCAGCTTCCTTCTCGATTTTCTG CATAAAACCATTAAAAGCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 31, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!