ID: 1000029727_1000029735

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1000029727 1000029735
Species Human (GRCh38) Human (GRCh38)
Location 5:157391143-157391165 5:157391191-157391213
Sequence CCAAGCAGCAAAGGTGGTATGGG CAGTGACAGCAGAGGCACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123} {0: 1, 1: 0, 2: 4, 3: 56, 4: 450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!