ID: 1000042032_1000042040

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1000042032 1000042040
Species Human (GRCh38) Human (GRCh38)
Location 5:157491898-157491920 5:157491938-157491960
Sequence CCCCTCAAAGCAAATCTGCACGG CAGTGCAATGGGAGGGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 98} {0: 1, 1: 0, 2: 2, 3: 32, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!