ID: 1000042035_1000042040

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1000042035 1000042040
Species Human (GRCh38) Human (GRCh38)
Location 5:157491900-157491922 5:157491938-157491960
Sequence CCTCAAAGCAAATCTGCACGGAG CAGTGCAATGGGAGGGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 108} {0: 1, 1: 0, 2: 2, 3: 32, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!