ID: 1000043448_1000043452

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1000043448 1000043452
Species Human (GRCh38) Human (GRCh38)
Location 5:157502255-157502277 5:157502269-157502291
Sequence CCGTGTACCCTCCACACTCACTG CACTCACTGTGAAGATCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 300} {0: 1, 1: 0, 2: 0, 3: 28, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!