ID: 1000044733_1000044741

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1000044733 1000044741
Species Human (GRCh38) Human (GRCh38)
Location 5:157512883-157512905 5:157512907-157512929
Sequence CCACCCTGACCTACCTCAATTCC TCCTAAGTCAGAGAATCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 281} {0: 1, 1: 0, 2: 2, 3: 9, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!