ID: 1000046763_1000046772

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1000046763 1000046772
Species Human (GRCh38) Human (GRCh38)
Location 5:157528267-157528289 5:157528320-157528342
Sequence CCAGACGGAAGCATGCAAAACAG CTCCCTTTCAGCACTGCTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 24, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!