ID: 1000186455_1000186462

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1000186455 1000186462
Species Human (GRCh38) Human (GRCh38)
Location 5:158863292-158863314 5:158863324-158863346
Sequence CCTTCCCAAGTTCCTCCCGACAG ATCCCACCTCAGTTTTCCAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 120} {0: 1, 1: 0, 2: 1, 3: 51, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!