|
Left Crispr |
Right Crispr |
| Crispr ID |
1000189596 |
1000189600 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:158897217-158897239
|
5:158897255-158897277
|
| Sequence |
CCATGGAATACTATGCAGCTATA |
TGTCCTTTGCGGGACATGGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 436, 1: 25124, 2: 14091, 3: 8335, 4: 5529} |
{0: 2, 1: 14, 2: 38, 3: 52, 4: 201} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|