ID: 1000200121_1000200124

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1000200121 1000200124
Species Human (GRCh38) Human (GRCh38)
Location 5:159000999-159001021 5:159001014-159001036
Sequence CCTCTTTTTTTCCAACTATATAT CTATATATATTTATGAAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 73, 4: 687} {0: 1, 1: 0, 2: 2, 3: 55, 4: 489}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!