ID: 1000201638_1000201648

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1000201638 1000201648
Species Human (GRCh38) Human (GRCh38)
Location 5:159016638-159016660 5:159016682-159016704
Sequence CCATGCCTATGACTGCAATGCCA GGCACTTGGGTGAGGACAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 197} {0: 1, 1: 0, 2: 1, 3: 26, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!