ID: 1000219161_1000219169

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1000219161 1000219169
Species Human (GRCh38) Human (GRCh38)
Location 5:159195456-159195478 5:159195488-159195510
Sequence CCATCTACAATCCCTTTACAAAC TTGTTTGCTCTAAAGAAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 218} {0: 2, 1: 0, 2: 1, 3: 20, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!