ID: 1000220178_1000220183

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1000220178 1000220183
Species Human (GRCh38) Human (GRCh38)
Location 5:159208173-159208195 5:159208205-159208227
Sequence CCAACCCAGCTCGCGGCAAGCAG CAGCAGTAGCAGCAGCAACCGGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 33, 3: 181, 4: 747}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!