ID: 1000220181_1000220185

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1000220181 1000220185
Species Human (GRCh38) Human (GRCh38)
Location 5:159208178-159208200 5:159208221-159208243
Sequence CCAGCTCGCGGCAAGCAGGCAGC AACCGGGCCGCCGCCGCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 95} {0: 1, 1: 0, 2: 4, 3: 22, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!