ID: 1000223243_1000223248

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1000223243 1000223248
Species Human (GRCh38) Human (GRCh38)
Location 5:159234238-159234260 5:159234273-159234295
Sequence CCCAGTAACAAGCCAAGAGCTGT GAGTAGGTATCTGCAGAAGATGG
Strand - +
Off-target summary {0: 7, 1: 192, 2: 203, 3: 165, 4: 275} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!