ID: 1000226094_1000226104

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1000226094 1000226104
Species Human (GRCh38) Human (GRCh38)
Location 5:159263357-159263379 5:159263395-159263417
Sequence CCAGGTGAGGGGTTGCGGGGCAC TTGGAGACGCTGTTGGGGCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 178} {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!