ID: 1000240040_1000240050

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1000240040 1000240050
Species Human (GRCh38) Human (GRCh38)
Location 5:159400817-159400839 5:159400866-159400888
Sequence CCAGCCTCAATTCCCTTTAATAG AATTATTGGGCTAAACACTATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!