ID: 1000250214_1000250220

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1000250214 1000250220
Species Human (GRCh38) Human (GRCh38)
Location 5:159487375-159487397 5:159487410-159487432
Sequence CCTGCCTTGGCAGGTGGCTCTCA AGGGTATCTCTCAGACCTCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!