ID: 1000289919_1000289930

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1000289919 1000289930
Species Human (GRCh38) Human (GRCh38)
Location 5:159860712-159860734 5:159860759-159860781
Sequence CCTTCCACTATCTACAGACACAG GAGCACAGGGTGGAAAGTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 20, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!