ID: 1000302076_1000302085

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1000302076 1000302085
Species Human (GRCh38) Human (GRCh38)
Location 5:159965463-159965485 5:159965499-159965521
Sequence CCCAGCAGCTTCACCCACCACAC CAGGTCTGTTTGGCTGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 306} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!