ID: 1000302362_1000302371

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1000302362 1000302371
Species Human (GRCh38) Human (GRCh38)
Location 5:159967785-159967807 5:159967828-159967850
Sequence CCATGAGAAAAGTTGGCATCACC CTTCTCAAGGCCATGGTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121} {0: 1, 1: 0, 2: 3, 3: 18, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!