ID: 1000307624_1000307632

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1000307624 1000307632
Species Human (GRCh38) Human (GRCh38)
Location 5:160009759-160009781 5:160009798-160009820
Sequence CCACGGTAATCCTGATTAGGGTC CCCTTCCAGTGTAAGCTGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32} {0: 1, 1: 0, 2: 0, 3: 6, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!