ID: 1000320279_1000320287

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1000320279 1000320287
Species Human (GRCh38) Human (GRCh38)
Location 5:160129187-160129209 5:160129220-160129242
Sequence CCACTGTGGAGGGGGTGGTTCTA TTGGTTTGCCTGGGACTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 180} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!