ID: 1000327298_1000327303

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1000327298 1000327303
Species Human (GRCh38) Human (GRCh38)
Location 5:160182058-160182080 5:160182073-160182095
Sequence CCTTTTAGTAGGGTGAAGGCATT AAGGCATTAGGTTACAGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!