ID: 1000334158_1000334168

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1000334158 1000334168
Species Human (GRCh38) Human (GRCh38)
Location 5:160229511-160229533 5:160229549-160229571
Sequence CCATTCTCCTCATCCCTCTGCTC CCCAGCAGCATGGCTTTCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 169, 4: 1411} {0: 1, 1: 0, 2: 1, 3: 21, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!