ID: 1000393489_1000393491

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1000393489 1000393491
Species Human (GRCh38) Human (GRCh38)
Location 5:160749085-160749107 5:160749108-160749130
Sequence CCATGTTCTTTCTGCGACTCCAG AAGTGAGTTATTAGTATTACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 241} {0: 1, 1: 1, 2: 0, 3: 11, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!