ID: 1000395593_1000395603

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1000395593 1000395603
Species Human (GRCh38) Human (GRCh38)
Location 5:160771834-160771856 5:160771883-160771905
Sequence CCTGTTTCACACATACTGTCTCC GGTACTGCTGGAAAGGGGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194} {0: 1, 1: 0, 2: 1, 3: 15, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!