ID: 1000413491_1000413494

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1000413491 1000413494
Species Human (GRCh38) Human (GRCh38)
Location 5:160958935-160958957 5:160958971-160958993
Sequence CCTGGATTATCTGTGTAGATCTG AATGTTAATAAGAGGGATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 228} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!