ID: 1000426802_1000426807

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1000426802 1000426807
Species Human (GRCh38) Human (GRCh38)
Location 5:161100751-161100773 5:161100779-161100801
Sequence CCATGAGGGTGAACACACAGGTA GTTAATATGTGGTTGAGGTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!