ID: 1000433400_1000433411

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1000433400 1000433411
Species Human (GRCh38) Human (GRCh38)
Location 5:161179262-161179284 5:161179310-161179332
Sequence CCCAGGAACAGCCACATGCTATG ACGGAGAGCACAGTGATGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!