ID: 1000487169_1000487173

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1000487169 1000487173
Species Human (GRCh38) Human (GRCh38)
Location 5:161861583-161861605 5:161861623-161861645
Sequence CCATATCTAGACTTAGTAGCTGA TAGCTCTACATATCATCTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 84} {0: 1, 1: 0, 2: 0, 3: 1, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!