ID: 1000503997_1000503999

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1000503997 1000503999
Species Human (GRCh38) Human (GRCh38)
Location 5:162091176-162091198 5:162091198-162091220
Sequence CCCATATTGCATTAAAAGTCTTG GAAGCAGCATACATAGATGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!