ID: 1000516486_1000516496

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1000516486 1000516496
Species Human (GRCh38) Human (GRCh38)
Location 5:162241475-162241497 5:162241502-162241524
Sequence CCCCTAGGGTCTCAGGGTTTTTA CATCGGATGGAGGGCGTGGAGGG
Strand - +
Off-target summary {0: 21, 1: 45, 2: 46, 3: 77, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!