ID: 1000534755_1000534758

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1000534755 1000534758
Species Human (GRCh38) Human (GRCh38)
Location 5:162466183-162466205 5:162466208-162466230
Sequence CCCTTGATGGAGCAGAACAGAAT TATTTGACATTCACTGGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!