ID: 1000621247_1000621260

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1000621247 1000621260
Species Human (GRCh38) Human (GRCh38)
Location 5:163489243-163489265 5:163489287-163489309
Sequence CCACTTACCTCCTGCTCTGCAGC ATGGGTATTGGTCTGTAGCCCGG
Strand - +
Off-target summary {0: 3, 1: 27, 2: 332, 3: 584, 4: 1275} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!