|
Left Crispr |
Right Crispr |
| Crispr ID |
1000621254 |
1000621264 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:163489265-163489287
|
5:163489296-163489318
|
| Sequence |
CCGGGTTCCTAACAGGCCTTGGA |
GGTCTGTAGCCCGGAGGTTGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 217, 2: 628, 3: 1120, 4: 1352} |
{0: 1, 1: 1, 2: 28, 3: 185, 4: 627} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|