ID: 1000652834_1000652839

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1000652834 1000652839
Species Human (GRCh38) Human (GRCh38)
Location 5:163838039-163838061 5:163838083-163838105
Sequence CCCAGTCTCATGGGAGAACAGAC AAGTGTGCCAAGCGCAAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!