ID: 1000699651_1000699660

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1000699651 1000699660
Species Human (GRCh38) Human (GRCh38)
Location 5:164433053-164433075 5:164433101-164433123
Sequence CCAGAAAAATGTTTCACAACCAG CTTGGTGCTAGGTGCATGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 274} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!