ID: 1000759005_1000759006

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1000759005 1000759006
Species Human (GRCh38) Human (GRCh38)
Location 5:165197854-165197876 5:165197879-165197901
Sequence CCTTATGAGTGGGAGCTAAATGA AGAACTCATGAACACAAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 30, 2: 49, 3: 75, 4: 224} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!