ID: 1000779683_1000779686

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1000779683 1000779686
Species Human (GRCh38) Human (GRCh38)
Location 5:165465156-165465178 5:165465172-165465194
Sequence CCAGTTCCTCTTCATATTACCAC TTACCACAGCCGGTGCTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 41, 3: 96, 4: 307} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!