ID: 1000817011_1000817014

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1000817011 1000817014
Species Human (GRCh38) Human (GRCh38)
Location 5:165936083-165936105 5:165936101-165936123
Sequence CCTTCTTTCCTCTGGGGTCCCAT CCCATTTGCTAGCATTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 350} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!